View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5298-Insertion-10 (Length: 167)
Name: NF5298-Insertion-10
Description: NF5298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5298-Insertion-10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 7 - 159
Target Start/End: Original strand, 3250292 - 3250445
Alignment:
| Q |
7 |
atatgcttgatgtctataaatataacaatgttagttttagtcatgtaagttatacttgcgtnnnnnnnnn-tgtcatgtaagttgttttggatttcatca |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
3250292 |
atatgcttgatgtctataaatataacaatgttagttttagtcatgtaagttatacttgcgtaaaaaaaaaatgtcatgcaagttgttttggatttcatca |
3250391 |
T |
|
| Q |
106 |
tacttcaaaagttagaaatgatgatttttagtccttaacatcaacaatcgttat |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3250392 |
tacttcaaaagttagaaatgatgatttttagtccttaacatcaacaatcgttat |
3250445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University