View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5298_high_15 (Length: 237)
Name: NF5298_high_15
Description: NF5298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5298_high_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 178; Significance: 4e-96; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 23 - 219
Target Start/End: Original strand, 39902016 - 39902210
Alignment:
| Q |
23 |
ggagtatcggtcactgtaatgagtttgtgaacctgattcatataccaaaataaacctatataattgtattctcaatcgttcactatattcgtgtattgtg |
122 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39902016 |
ggagtatctgtcactgtaatgagtttgtgaacctgattcgtataccaaaataaacctatataattgtattctcaatcgttcactatattcgtgtattgt- |
39902114 |
T |
|
| Q |
123 |
taagcctttgagttacatattaccagtataaaataatataatgcacattgtctcgctgcactgtagaacgactcttaattgacactaccagtatcaa |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39902115 |
-aagcctttgagttacatattaccagtataaaataatataatgcacattgtctcgctgcactgtagaacgactcttaattgacactaccagtatcaa |
39902210 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 156 - 203
Target Start/End: Complemental strand, 39901962 - 39901915
Alignment:
| Q |
156 |
taatataatgcacattgtctcgctgcactgtagaacgactcttaattg |
203 |
Q |
| |
|
|||||| ||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
39901962 |
taatatcatgcacattgtcttgctgcactgtaggacgactcttaattg |
39901915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University