View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5298_high_16 (Length: 201)
Name: NF5298_high_16
Description: NF5298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5298_high_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 83 - 186
Target Start/End: Original strand, 45717708 - 45717811
Alignment:
| Q |
83 |
atgctaattaattcttgtgttataaatacaggtcgagttttggatatgtttgattctcaccattttgggttatcttcctggaattatctatgctacctat |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45717708 |
atgctaattaattcttgtgttataaatacaggtcgagttttggatatgtttgattctcaccattttgggttatcttcctggaattatctatgctatctat |
45717807 |
T |
 |
| Q |
183 |
gcta |
186 |
Q |
| |
|
|||| |
|
|
| T |
45717808 |
gcta |
45717811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 100 - 182
Target Start/End: Original strand, 45705366 - 45705448
Alignment:
| Q |
100 |
tgttataaatacaggtcgagttttggatatgtttgattctcaccattttgggttatcttcctggaattatctatgctacctat |
182 |
Q |
| |
|
||||||||||| |||| ||||| ||||| |||||| | |||||| |||| || ||||||||||||||||||||||||| |||| |
|
|
| T |
45705366 |
tgttataaatataggtggagttctggatctgtttggtgctcaccctttttggctatcttcctggaattatctatgctatctat |
45705448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University