View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5299_high_8 (Length: 258)
Name: NF5299_high_8
Description: NF5299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5299_high_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 100 - 241
Target Start/End: Complemental strand, 43687694 - 43687553
Alignment:
| Q |
100 |
ttaataaatcacaagcattcttacaaataccttgaacgtaaccgtagcagctttttagacgatcttcgagttcaactagatcggtttgattcttcttgta |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
43687694 |
ttaataaatcacaagcattcttacaaataccttgaacgtaaccgtagcagctttttagacgatcttcgagttcagctagatcggtttgattcttcttgta |
43687595 |
T |
|
| Q |
200 |
caattcgttgcagtgacctaaaagctcttcaaacgaaactgt |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43687594 |
caattcgttgcagtgacctaaaagctcttcaaacgaaactgt |
43687553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University