View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5300_high_3 (Length: 238)
Name: NF5300_high_3
Description: NF5300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5300_high_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 11 - 222
Target Start/End: Original strand, 26468200 - 26468411
Alignment:
| Q |
11 |
aatgattggttcctctcttggtcatcaataatgcattattgaattaaattgtgttgacaataggtgatatgcagtgcaacaaagtccatggattcaattc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26468200 |
aatgattggttcctctcttggtcatcaagaatgcattattgaattaaattgtgtcgacaataggtgatatgcagtgcaacaaagtccatggattcaattc |
26468299 |
T |
 |
| Q |
111 |
acgttgctgtaatttcaaatctcaattttgttcatgatatgataattcttaccaatttttgaaatgtatgcataacgtttatttaaataatgactttatc |
210 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26468300 |
acgtcgctgtaatttcaaatctcaattttgttcatgatatgataattcttaccaatttttggaatgtatgcataacgtttatttaaataatgactttatc |
26468399 |
T |
 |
| Q |
211 |
tcaattgatgac |
222 |
Q |
| |
|
||||| |||||| |
|
|
| T |
26468400 |
tcaatcgatgac |
26468411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 127 - 214
Target Start/End: Original strand, 6348494 - 6348582
Alignment:
| Q |
127 |
aaatctcaattttgttcatgatatgataattcttaccaattt-ttgaaatgtatgcataacgtttatttaaataatgactttatctcaa |
214 |
Q |
| |
|
|||||||||| || |||||||||||| ||| ||| |||| | |||||| ||||| |||| ||| |||| |||||||||||||||||| |
|
|
| T |
6348494 |
aaatctcaatgttattcatgatatgaaaatacttgccaaataattgaaaggtatggataaggttgattttgataatgactttatctcaa |
6348582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University