View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5300_low_3 (Length: 330)
Name: NF5300_low_3
Description: NF5300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5300_low_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 264; Significance: 1e-147; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 34 - 313
Target Start/End: Complemental strand, 52400601 - 52400322
Alignment:
| Q |
34 |
aaaagggtaaaaggcactaaaactttcaaagatagtgtcctgaattataaagaatgaaaatgacaaccttaacgttaccagcctccttaattgcagcgat |
133 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
52400601 |
aaaagggtaaaaggcactgaaactttcaaagattgtgtcctgaattataaagaatgaaaatgacaaccttaacattaccagcctccttaattgcagcgat |
52400502 |
T |
 |
| Q |
134 |
aatcttcacttgatcctcaatctgagcgtggcctaccgtagatatgaccacagctacctgcttgattgctttcaccaagttctcatgattatacagatcc |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52400501 |
aatcttcacttgatcctcaatctgagcgtggcctaccgtagatatgaccacatctacctgcttgattgctttcaccaagttctcatgattatacagatcc |
52400402 |
T |
 |
| Q |
234 |
ccctgcaaacttaatattattaatcaatgatatacgaacacgatacgagttaatatttctagccaaaggatcactctctg |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52400401 |
ccctgcaaacttaatattattaatcaatgatatacgaacacgatacgagttaatatttctagccaaaggatcactctctg |
52400322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 173 - 239
Target Start/End: Complemental strand, 52407284 - 52407218
Alignment:
| Q |
173 |
agatatgaccacagctacctgcttgattgctttcaccaagttctcatgattatacagatccccctgc |
239 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||| |||||| || || |||||||||||| |
|
|
| T |
52407284 |
agatatgaccacgtctacctgcttcattgctttcaccaagctctcattatcgtagagatccccctgc |
52407218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University