View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5300_low_4 (Length: 261)
Name: NF5300_low_4
Description: NF5300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5300_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 82; Significance: 8e-39; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 116 - 205
Target Start/End: Complemental strand, 33525631 - 33525542
Alignment:
| Q |
116 |
gcataaccatgaaccattttgagaacacagctcttgatgattcgctgtcacgatgagtctcttctacaccaacatgatcgttataataca |
205 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33525631 |
gcatcaccatgaaccattttgagaacacagctcttgatgattcgctgtcgcgatgagtctcttctacaccaacatgatcgttataataca |
33525542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 18 - 63
Target Start/End: Complemental strand, 33525729 - 33525684
Alignment:
| Q |
18 |
caataatgcatttggaggaggcacagagatttctccatcaccacag |
63 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33525729 |
caataatgcatttggaggaggcacagagatttctccatcaccacag |
33525684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University