View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5300_low_6 (Length: 232)
Name: NF5300_low_6
Description: NF5300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5300_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 31 - 213
Target Start/End: Complemental strand, 35906883 - 35906701
Alignment:
| Q |
31 |
ggcgtacaggaaattattattctctcacaacttgtcaccaagaacacccaaaaagccttcatannnnnnncctgtacgcccaagtattatattacatgca |
130 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
35906883 |
ggcgtacaggaaattattattctctcacaacttgtcaccaagaacacccaaaaagccttcatatttttttcctgtacgcccaagtattatattacatgca |
35906784 |
T |
 |
| Q |
131 |
tatttctttgcatttcattgaattgatcaaaaaatgagaatgcaaaagagtttatgtctcttccttataatgtatatacctat |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35906783 |
tatttctttgcatttcattgaattgatcaaaaaatgagaatgcaaaagagtttatgtctcttccttataatgtatatacctat |
35906701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University