View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5301-Insertion-20 (Length: 337)
Name: NF5301-Insertion-20
Description: NF5301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5301-Insertion-20 |
 | |
|
| [»] scaffold0044 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0044 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: scaffold0044
Description:
Target: scaffold0044; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 38 - 337
Target Start/End: Original strand, 91719 - 92022
Alignment:
| Q |
38 |
tgcaggtttcaaatgatatatctggatacgtctcttatttgttatatttcagttggttatgatgaacaaaatagatacatatccaattatatattttctt |
137 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| | ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
91719 |
tgcaggtttcaaataatatatctggatacgtctgtcattcgttatatttcagttggttatgatgaacaaaatagatacatatccaattatatattttcct |
91818 |
T |
|
| Q |
138 |
tccccaagaaattttccgaaaatggttgtactaatatcaccattgcacaaccatgaagcattaaccgtggt----cgcataactcgaaaaggtctgtaaa |
233 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
91819 |
tccccaaaaaattgtccgaaaatggttgtactaatatcaccattgcacaaccatgaagcattaaccgtggtcgcacgcataactcgaaaaggtctgtaaa |
91918 |
T |
|
| Q |
234 |
tctccggcaactactcggtcatttcatctttccgattgtggtatctcatgatttgggatatgcttgtgtttggttcttcaaaactcgcttgctaatggtc |
333 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
91919 |
tctccggcacctactcggtcatttcatctttccgattgtggtatctcatgatttgggttgtgcttgtgtttggttcttcaaaactcgcttgctaatggtc |
92018 |
T |
|
| Q |
334 |
cttc |
337 |
Q |
| |
|
|||| |
|
|
| T |
92019 |
cttc |
92022 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University