View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5301_high_10 (Length: 379)
Name: NF5301_high_10
Description: NF5301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5301_high_10 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 20 - 369
Target Start/End: Complemental strand, 9684557 - 9684209
Alignment:
| Q |
20 |
taggcttgtgaactagtccttttgatgttgtgagtgaattttggtcctttcatttgtgttttcattttcaatccttgtcatcaacttgtcttgatgtgtg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9684557 |
taggcttgtgaactagtccttttgatgttgtgagtgaattttggtcctttcatttgtgttttcattttcaatccttgtcatcaacttgtcttgatgtgtg |
9684458 |
T |
|
| Q |
120 |
catagaaaaagcttacacatgagaaaaatggtctatatgaggaaactttgttgatgatgagtttctgaatattttgtggctacaagttcttaaggtattt |
219 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
9684457 |
catagaaaaagctgacacatgagaaaaatggtctatatgaggaaactttgttgatgatgagtttctgaatattttgtggctacaagttctgaaggtattt |
9684358 |
T |
|
| Q |
220 |
gaagttctattgttttcttatggttatacatgtttatttgttcttcaaattttgaattctaattaaacacttcttcactcatataaagcnnnnnnnnnat |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
9684357 |
gaagttctattgttttcttatggttatacatgtttgtttgttcttcaaattttgaattctaattaaacacttcttcactcatataaagc-ttttttttat |
9684259 |
T |
|
| Q |
320 |
gttgagttatatcatatcaaaacctttcttaagtgcttctactttctgtg |
369 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9684258 |
gttgagttatatcatatcaaaacctttcttaagtgcttctactttctgtg |
9684209 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University