View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5301_high_18 (Length: 264)
Name: NF5301_high_18
Description: NF5301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5301_high_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 13 - 246
Target Start/End: Original strand, 37271789 - 37272022
Alignment:
| Q |
13 |
catcatcatgccgtgcttctagacgtgactataacccaggacatgacaaacatggtgcattggttaaggacaaagagaacctagaagacttctgaattct |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37271789 |
catcatcatgccgtgcttctagacgtgactataacccaggacatgacaaacatggtgcattggttaaggacaaagagaacctagaagacttctgaattct |
37271888 |
T |
 |
| Q |
113 |
tatagaagaattaagaagcaaaatttgccaagtttaacacaaagatggtaatccaaacacggtgcttgaaggggacactttggatattcttggcagtgaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37271889 |
tatagaagaattaagaagcaaaatttgccaagtttaacacaaagatggtaatccaaacacggtgcttgaaggggacactttggatattcttggcagtgaa |
37271988 |
T |
 |
| Q |
213 |
ggacagagaatcggattcagagtttatactgttg |
246 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |
|
|
| T |
37271989 |
ggacagagaatcggattcggagtttatactgttg |
37272022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University