View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5301_high_20 (Length: 254)
Name: NF5301_high_20
Description: NF5301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5301_high_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 38; Significance: 0.000000000001; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 22070143 - 22070106
Alignment:
| Q |
1 |
cgtgatattaactatatagtataaatcataaactttaa |
38 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22070143 |
cgtgatattaactatatagtataaatcataaactttaa |
22070106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 207 - 244
Target Start/End: Complemental strand, 22069933 - 22069896
Alignment:
| Q |
207 |
caaaatttgaaaactagctgacaatgtggccgcctttg |
244 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
22069933 |
caaaatttggaaactagctgacaatgtggccgcctttg |
22069896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 203 - 246
Target Start/End: Original strand, 17058779 - 17058822
Alignment:
| Q |
203 |
tgaccaaaatttgaaaactagctgacaatgtggccgcctttgct |
246 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
17058779 |
tgaccaaaatttggaaactagctgacaatgtggtcgcctttgct |
17058822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University