View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5301_low_25 (Length: 232)

Name: NF5301_low_25
Description: NF5301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5301_low_25
NF5301_low_25
[»] chr1 (1 HSPs)
chr1 (31-222)||(34607776-34607975)


Alignment Details
Target: chr1 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 31 - 222
Target Start/End: Original strand, 34607776 - 34607975
Alignment:
31 tctcttttaggtttttgagaccgggatccagaatattcaacaaca---caactaatttaatgtgactatgaatgaatgatgcaaagtttattagacttta 127  Q
    |||||||||| | ||||||||||||||||||||||||||||||||   ||||||||||||||||||||||||||||||||| |||||||||||||||| |    
34607776 tctcttttagatgtttgagaccgggatccagaatattcaacaacaacacaactaatttaatgtgactatgaatgaatgatgaaaagtttattagacttga 34607875  T
128 ttagatt-----ggcaattttgcatggatgaaaagtgtagggtgttgcattatatgagccaaatagaggttgaattgatcgaagctataggtggaagtag 222  Q
    |||||||     ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34607876 ttagattatattggcaattttgcatggatgaaaagtgtagggtgttgcattatatgagccaaatagaggttgaattgatcgaagctataggtggaagtag 34607975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University