View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5301_low_27 (Length: 221)
Name: NF5301_low_27
Description: NF5301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5301_low_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 4 - 211
Target Start/End: Original strand, 54952502 - 54952709
Alignment:
| Q |
4 |
gactcgagtctaaaatataaagttagagcatgaattgtctgatcttaatccgacggtctaaatgtgaacaatttaattcaaattccacatatattcacac |
103 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54952502 |
gactcgagtctaaaatataaaattagagcatgaattgtctaatcttgatccgacggtctaaatgtgaacaatttaattcaaattccacatatattcacac |
54952601 |
T |
 |
| Q |
104 |
taaacaatttccaattatggaattgaccaaatagtgattttattcattatgctaactataattatgatcttaattaatattcttaaacaaattttcagtc |
203 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54952602 |
taaacaatttccaattatggtattgaccaaagagtgattttattcattatgctaacgataattatgatcttaattaatattcttaaacaaattttcagtc |
54952701 |
T |
 |
| Q |
204 |
tttctctg |
211 |
Q |
| |
|
|||||||| |
|
|
| T |
54952702 |
tttctctg |
54952709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University