View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5302_high_5 (Length: 284)
Name: NF5302_high_5
Description: NF5302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5302_high_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 26 - 274
Target Start/End: Complemental strand, 28323848 - 28323602
Alignment:
| Q |
26 |
ttattacaaatagaaagg-ttttgttgttattcaatataaaatgattgaacgtttataattttgttttctcttggacatgataacactggaaagagcagt |
124 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||| ||||||||| || |
|
|
| T |
28323848 |
ttattacaaatacaaaggattttgttgttattcaatataaaatgattgaaagtttataatttttttttctcttggacatgataacaccggaaagagctgt |
28323749 |
T |
|
| Q |
125 |
tctatgatttttaatccttataaaataaattatcatgaagactcaaaacacaaaagtcgtgtctggtaccgaagtctgccaatnnnnnnnnntctcaact |
224 |
Q |
| |
|
||||||| | |||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
28323748 |
tctatga-ctctaatccttataaaataaattgtcatgaacactcaaaacacaaaagtcgtgtctggtaccgaagtctgccaat--aaaaaaatctcaact |
28323652 |
T |
|
| Q |
225 |
agcaaaggatttgaatgggtcatcaaagaagacgtattttggcatctctg |
274 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
28323651 |
agcaaaggatttgaatgggtcattaaagaagacgtattttggtatctctg |
28323602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University