View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5302_low_10 (Length: 225)
Name: NF5302_low_10
Description: NF5302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5302_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 8 - 220
Target Start/End: Original strand, 35416377 - 35416589
Alignment:
| Q |
8 |
aaaccaagctgcatggcaaagactaaataagctgagaagagaaggtaggtgttgtctattgcataggtggtgtcgctgagtttatttgagatggtgttga |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
35416377 |
aaaccaagctgcatggcaaagactaaataagctgagaagagaaggtaggtgttgtctattgcataagtggtgtcgctgagtttatttgagatggtgttga |
35416476 |
T |
 |
| Q |
108 |
attgggtgcagaggtagtctgcaaccgcggtagcgtttgcagcggttgtgaggagtggggcgaggtctgtggctgagcaagatacagaagccatatctgt |
207 |
Q |
| |
|
|||||||||| |||||||| || || |||||||||||||||||||| ||||||||||| |||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
35416477 |
attgggtgcataggtagtcagctacagcggtagcgtttgcagcggtggtgaggagtggagcgaagtctgtggctgagcaagatagagaagccatatctgt |
35416576 |
T |
 |
| Q |
208 |
cgtgaagtgagtg |
220 |
Q |
| |
|
|| |||||||| |
|
|
| T |
35416577 |
tgtacagtgagtg |
35416589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University