View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5302_low_8 (Length: 250)
Name: NF5302_low_8
Description: NF5302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5302_low_8 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 53 - 250
Target Start/End: Original strand, 35416799 - 35416993
Alignment:
| Q |
53 |
catgacaacagaaagaatatatttaaattgtggaatgaatcatcaatgatcgatagtacttttggggttagaagaacttgttctgtcctcctcattgctt |
152 |
Q |
| |
|
|||| |||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||| |
|
|
| T |
35416799 |
catgccaacagaaagaatataattaaattttggaatgaatcatcaatgatcgatagtacttttggggttagaa---cttgttctgtcctcctcattactt |
35416895 |
T |
 |
| Q |
153 |
atcttttcctcatttctgtgtcccacctttatgtagttttgtatagtttacttgtgtgcaacattgccactaaaatgcatccatatcattgttattat |
250 |
Q |
| |
|
||| |||||||||||||||||||||||||| |||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
35416896 |
atcatttcctcatttctgtgtcccacctttgtgtagttttgtatagtatacttgtgtgcaatattgccactaaaatgcatccatatcattgttattat |
35416993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University