View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5303-Insertion-3 (Length: 340)
Name: NF5303-Insertion-3
Description: NF5303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5303-Insertion-3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 7 - 199
Target Start/End: Complemental strand, 48894252 - 48894060
Alignment:
| Q |
7 |
agaatccaaaagggctagcgacattggtgctatgatgaatttagctggttttaatgggaataataacaatggtgctggtagtgctactgttgtaggtgga |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48894252 |
agaatccaaaagggctagcgacattggtgctatgatgaatttagctggttttaatgggaacaataacaatggtgctggtagtgctactgttgtaggtgga |
48894153 |
T |
|
| Q |
107 |
aattccaatggtttaggaggttttcctgcaggatccactgcatctattccaaatggtggtattgttactggccagtatccaccatctatgtta |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
48894152 |
aattccaatggtttaggaggttttcctgcaggatccactgcatctattccaaatggtggttttgttactggccagtatccaccatctatgtta |
48894060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 133 - 196
Target Start/End: Complemental strand, 24743001 - 24742938
Alignment:
| Q |
133 |
tgcaggatccactgcatctattccaaatggtggtattgttactggccagtatccaccatctatg |
196 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||| ||||||||||||| |||||| |||||||| |
|
|
| T |
24743001 |
tgcaggatcctttgcagctattccaaatggtggttttgttactggccaatatccatcatctatg |
24742938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University