View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5303-Insertion-3 (Length: 340)

Name: NF5303-Insertion-3
Description: NF5303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5303-Insertion-3
NF5303-Insertion-3
[»] chr1 (1 HSPs)
chr1 (7-199)||(48894060-48894252)
[»] chr4 (1 HSPs)
chr4 (133-196)||(24742938-24743001)


Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 7 - 199
Target Start/End: Complemental strand, 48894252 - 48894060
Alignment:
7 agaatccaaaagggctagcgacattggtgctatgatgaatttagctggttttaatgggaataataacaatggtgctggtagtgctactgttgtaggtgga 106  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
48894252 agaatccaaaagggctagcgacattggtgctatgatgaatttagctggttttaatgggaacaataacaatggtgctggtagtgctactgttgtaggtgga 48894153  T
107 aattccaatggtttaggaggttttcctgcaggatccactgcatctattccaaatggtggtattgttactggccagtatccaccatctatgtta 199  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
48894152 aattccaatggtttaggaggttttcctgcaggatccactgcatctattccaaatggtggttttgttactggccagtatccaccatctatgtta 48894060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 133 - 196
Target Start/End: Complemental strand, 24743001 - 24742938
Alignment:
133 tgcaggatccactgcatctattccaaatggtggtattgttactggccagtatccaccatctatg 196  Q
    ||||||||||  |||| ||||||||||||||||| ||||||||||||| |||||| ||||||||    
24743001 tgcaggatcctttgcagctattccaaatggtggttttgttactggccaatatccatcatctatg 24742938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University