View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5303_high_14 (Length: 342)
Name: NF5303_high_14
Description: NF5303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5303_high_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 5e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 5e-90
Query Start/End: Original strand, 32 - 232
Target Start/End: Original strand, 48047223 - 48047418
Alignment:
| Q |
32 |
atagatagatagatactacaagagtaaactagattttgcagttattgtaatcgtatttttattgaactccaaacatgcaacacggtaacatatgcatgca |
131 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||| | |
|
|
| T |
48047223 |
atagatagatagatactacaagagtaaactagattttgcagttattgtactcgtattttc-ttgaactccaaacatgcaacacggtaacatatgc----a |
48047317 |
T |
 |
| Q |
132 |
tgcatgtagttagtatatcacaattcacaactctcaatttgaagattacacgatgatgaggttggttatcagtcttctccaatttcattttcctcactat |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48047318 |
tgcatgtagttagtatatcacaattcacaactctcaatttgaagattacacgatgatgaggttggttatcagtcttctccaatttcattttcctcactat |
48047417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University