View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5303_high_15 (Length: 336)
Name: NF5303_high_15
Description: NF5303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5303_high_15 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 168; Significance: 5e-90; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 168; E-Value: 5e-90
Query Start/End: Original strand, 135 - 310
Target Start/End: Original strand, 3919549 - 3919724
Alignment:
| Q |
135 |
atactaaacttgatcatgcatatattaagaacatttgtgctactaactagtattgttatatcacatagaaaaatatgtgaatgaaacatcatgtacgtat |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3919549 |
atactaaacttgatcatgtatatattaagaacatttgtgctactaactagtatagttatatcacatagaaaaatatgtgaatgaaacatcatgtacgtat |
3919648 |
T |
|
| Q |
235 |
ctcccatgtgccctgtgtccccttactttgatgacaatcttattgttaaatctgaactcaatagataaaatactga |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3919649 |
ctcccatgtgccctgtgtccccttactttgatgacaatcttattgttaaatctgaactcaatagataaaatactga |
3919724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 26 - 80
Target Start/End: Original strand, 3919440 - 3919494
Alignment:
| Q |
26 |
atatagttttataaccatgtgaatcaatttatatggttaatttatagtctgtatg |
80 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
3919440 |
atatagttttataaccatgtcaatcaatttatatggttaatttatagtctgtatg |
3919494 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University