View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5303_high_29 (Length: 241)
Name: NF5303_high_29
Description: NF5303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5303_high_29 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 19 - 241
Target Start/End: Complemental strand, 13767091 - 13766869
Alignment:
| Q |
19 |
gccccttcacccatgtccctcaagtaaattctctttctctctcacaaatatttagcaaccaaaataatttggttctattattccgtattaacttaattct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13767091 |
gccccttcacccatgtccctcaagtaaattctctttctctttcacaaatattcagcaaccaaaataatttggttctattattccgtattaacttaattct |
13766992 |
T |
 |
| Q |
119 |
tcttgagagaattaatgtagttgagggacatgagtgaaatgacattgaatcaacgtggatgatcaatttagttaagggacatgagtgaagtggcattgga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13766991 |
tcttgagagaattaatgtagttgagggacatgggtgaaatgacattgaaccaacgtggatgatcaatttagttaagggacatgagtgaagtggcattgga |
13766892 |
T |
 |
| Q |
219 |
ttacaaagcagtgttgctcaatc |
241 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
13766891 |
ttacaaagcagtgttgctcaatc |
13766869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 164 - 241
Target Start/End: Original strand, 13767100 - 13767177
Alignment:
| Q |
164 |
tgaatcaacgtggatgatcaatttagttaagggacatgagtgaagtggcattggattacaaagcagtgttgctcaatc |
241 |
Q |
| |
|
|||||||||||| | |||||||| |||| | ||||||||||||||||||||||| |||| | |||||| ||||||| |
|
|
| T |
13767100 |
tgaatcaacgtgaaggatcaattgagttgcgcgacatgagtgaagtggcattggacgacaaggtagtgtttctcaatc |
13767177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University