View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5303_high_32 (Length: 209)

Name: NF5303_high_32
Description: NF5303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5303_high_32
NF5303_high_32
[»] chr2 (2 HSPs)
chr2 (85-145)||(12128645-12128705)
chr2 (1-59)||(12128560-12128618)


Alignment Details
Target: chr2 (Bit Score: 61; Significance: 2e-26; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 85 - 145
Target Start/End: Original strand, 12128645 - 12128705
Alignment:
85 cggtccttgtgatgtgtgttgagaaagggttttcttgttatggtaatatatattccatttt 145  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12128645 cggtccttgtgatgtgtgttgagaaagggttttcttgttatggtaatatatattccatttt 12128705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 12128560 - 12128618
Alignment:
1 agcatatcccatgatcgagttggcttaatactcttgagtgccttctcgttgtttcatag 59  Q
    ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
12128560 agcatatcccatgatcgagttggcttaatcctcttgagtgccttctcgttgtttcatag 12128618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University