View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5303_low_14 (Length: 359)
Name: NF5303_low_14
Description: NF5303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5303_low_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 17 - 343
Target Start/End: Complemental strand, 41390472 - 41390154
Alignment:
| Q |
17 |
agtttattcatcattggtcacactaacaagtctagcatgcctggtcactttctccctcaaacgttcagtcacccttgctgcatcaacatcttctccttta |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41390472 |
agtttattcatcattggtcacactaacaagtctagcatgcctggtcactttctccctcaaatgttcagtcacccttgctgcatcaacatcttctccttta |
41390373 |
T |
 |
| Q |
117 |
atcaccactctatcttttccttccctttccaaagtaaccattgtaacacctacatcatgcacaaatttattagttaattaaccctagtaacaatattaca |
216 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||| |||||| |||||||||| |||||||||||||||| |
|
|
| T |
41390372 |
atcaccactctatctcttccttccctttccaaagtaaccattgtaacacctatatcattcacaaa--------ttaattaaccttagtaacaatattaca |
41390281 |
T |
 |
| Q |
217 |
ctagttcctaatattgaagttaaaaatataatagtgaaacattttaattgaataaagaaatatgtattattgcatcttttgtgtgtttatgttattgact |
316 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
41390280 |
ctagttcctaatattgaagtgaaaaatataatagtgaaacattttaattgaataaagaaatatgtattattgcatcttttgtgtcttcatgttattgact |
41390181 |
T |
 |
| Q |
317 |
tattgttgttgagtatctctaattttt |
343 |
Q |
| |
|
|||||||||||||||||||| |||||| |
|
|
| T |
41390180 |
tattgttgttgagtatctctgattttt |
41390154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University