View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5303_low_19 (Length: 328)
Name: NF5303_low_19
Description: NF5303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5303_low_19 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 83; Significance: 3e-39; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 219 - 313
Target Start/End: Original strand, 41133176 - 41133269
Alignment:
| Q |
219 |
gttggatttttctccgtttcttataaaaggttagtgcttttgctttcattatcaatgaatatatcgttttctattaattttattaaatgggtcat |
313 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41133176 |
gttggttttttctccgtttcttataaa-ggttagtgcttttgctttcattatcaatgaatatatcgttttctattaattttattaaatgggtcat |
41133269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 19 - 99
Target Start/End: Original strand, 41132979 - 41133059
Alignment:
| Q |
19 |
cctacttcgttttcaccatacccaactcagtcagatccattgccttcttcttccccttcccccctttctcaccattttctt |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41132979 |
cctacttcgttttcaccatacccaactcagtcagatccattgccttcttcttccccttcccccctttctcaccattttctt |
41133059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 164 - 193
Target Start/End: Original strand, 41133124 - 41133153
Alignment:
| Q |
164 |
tctaagtatttgtttatttaaatcaagaaa |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
41133124 |
tctaagtatttgtttatttaaatcaagaaa |
41133153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University