View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5303_low_21 (Length: 325)
Name: NF5303_low_21
Description: NF5303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5303_low_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 8e-92; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 8e-92
Query Start/End: Original strand, 116 - 314
Target Start/End: Complemental strand, 29127456 - 29127258
Alignment:
| Q |
116 |
gaaatcatcttaagcaacaattatttgtcgtacttgtgcaaatatatcatttagactgcatagcatgctatattagtttacaattataactaattgctat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
29127456 |
gaaatcatcttaagcaacaattatttgtcgtacttgtgcaaatatatcatttagactgtatagcatgtcatattagtttacaattataactaattgctat |
29127357 |
T |
 |
| Q |
216 |
catagtctcatagtttgggcctaattgaagaggagcaatgcacaagacaaatagatgcaaatataaaccaatataacgaaataggtatcccatagaata |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||| |||| ||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
29127356 |
catagtctcatagtttgggcctaattgaagaggagcaatgcacaacacaaatggatgtaaatataaaccaatataacgaaacaggtatcccatagaata |
29127258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 18 - 50
Target Start/End: Complemental strand, 29127554 - 29127522
Alignment:
| Q |
18 |
tatacaagtgctgatgataaatttgaactttgg |
50 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
29127554 |
tatacaagtgctgatcataaatttgaactttgg |
29127522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University