View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5303_low_36 (Length: 209)
Name: NF5303_low_36
Description: NF5303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5303_low_36 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 24 - 161
Target Start/End: Original strand, 4946973 - 4947110
Alignment:
| Q |
24 |
gcatgtccaagaatattcgacaactttggctttcactttgatgacaacgaaaccacaccaaattgtttcccagttgaaactcatcctgatgatcaaacaa |
123 |
Q |
| |
|
|||| ||||| | |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4946973 |
gcatctccaacattattcgacaactttggctttcactttgatgacaacgaaacgacaccaaattgtttcccagttgaaactcatcctgatgatcaaacaa |
4947072 |
T |
 |
| Q |
124 |
ggccaaccaagaagatcaagacatcgagaaccccttct |
161 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
4947073 |
ggccaaccaagaagatcaagacatcgataaccccttct |
4947110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University