View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5303_low_37 (Length: 209)
Name: NF5303_low_37
Description: NF5303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5303_low_37 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 61; Significance: 2e-26; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 85 - 145
Target Start/End: Original strand, 12128645 - 12128705
Alignment:
| Q |
85 |
cggtccttgtgatgtgtgttgagaaagggttttcttgttatggtaatatatattccatttt |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12128645 |
cggtccttgtgatgtgtgttgagaaagggttttcttgttatggtaatatatattccatttt |
12128705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 12128560 - 12128618
Alignment:
| Q |
1 |
agcatatcccatgatcgagttggcttaatactcttgagtgccttctcgttgtttcatag |
59 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
12128560 |
agcatatcccatgatcgagttggcttaatcctcttgagtgccttctcgttgtttcatag |
12128618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University