View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5304_low_6 (Length: 240)

Name: NF5304_low_6
Description: NF5304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5304_low_6
NF5304_low_6
[»] chr1 (1 HSPs)
chr1 (1-221)||(31280770-31280990)


Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 31280770 - 31280990
Alignment:
1 tacactgtgatagttttgagttactggcagttggctttctgtggatattgggcttttggatcacaagtccaaccttacattttagcttctctttccattc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31280770 tacactgtgatagttttgagttactggcagttggctttctgtggatattgggcttttggatcacaagtccaaccttacattttagcttctctttccattc 31280869  T
101 cagaatggactgttgttatggcaaatttatttgcagctattcaaatatgtggatgctttcaggtaaagtctcttatacacttcaacacaatagagtatga 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
31280870 cagaatggactgttgttatggcaaatttatttgcagctattcaaatatgtggatgctttcaggtaaagtctcttatacactacaacacaatagagtatga 31280969  T
201 ttctgtttggaacttcctgtg 221  Q
    |||||||||||||||||||||    
31280970 ttctgtttggaacttcctgtg 31280990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University