View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5305-Insertion-3 (Length: 154)
Name: NF5305-Insertion-3
Description: NF5305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5305-Insertion-3 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 80; Significance: 7e-38; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 80; E-Value: 7e-38
Query Start/End: Original strand, 8 - 154
Target Start/End: Complemental strand, 11852974 - 11852827
Alignment:
| Q |
8 |
cttgcctgcctcctaattccctcactcaacattatcttatcaccaaccatttagtttcttaagataaaatttgctataggaatctcaactatggaagttc |
107 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||| ||||||| |
|
|
| T |
11852974 |
cttgcctgcctcctaattcactcactcaacattatcttatcaccaaccatttagtttcttaagataaaaattgctataggaatctc-cctat-gaagttc |
11852877 |
T |
|
| Q |
108 |
t--caatactctatgctc-attatgatctttcttatt-agatgcttgcagc |
154 |
Q |
| |
|
| |||||||| ||||| |||||||||||||||||| ||||||| ||||| |
|
|
| T |
11852876 |
ttcaaatactct-tgctcaattatgatctttcttattaagatgctagcagc |
11852827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University