View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5305_low_7 (Length: 285)
Name: NF5305_low_7
Description: NF5305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5305_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 5 - 264
Target Start/End: Original strand, 20456357 - 20456619
Alignment:
| Q |
5 |
gatggccgtcatattggcattggcttgaacaactctgaagtgcagctatgggatacagcttcagatagacaggttttatacttatctggtttacccttca |
104 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20456357 |
gatgggcgtcatattggcattggtttgaacaactctgaagtgcagctatgggatacagcttcagatagacaggttttatacttatctggtttacccttca |
20456456 |
T |
 |
| Q |
105 |
aatgatacatcattatgagctattcagtatccatttcctaatactagttttctaatattgttcatgttatgtttctgcagttgagaaatatgaaaggtgg |
204 |
Q |
| |
|
|| ||||||||||||||||||||| |||||||| |||||| |||||||||||||||||| ||| |||||| |||||||||||||||| | |||||||||| |
|
|
| T |
20456457 |
aacgatacatcattatgagctattgagtatccaattcctactactagttttctaatattattcttgttatatttctgcagttgagaactttgaaaggtgg |
20456556 |
T |
 |
| Q |
205 |
gcatag---gcagcgagtagggtctttggcatggaataaccacacactcacaactggagggat |
264 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
20456557 |
gcataggcagcagcgagtagggtctttggcatggaataaccacatactcacaacaggagggat |
20456619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 69; Significance: 5e-31; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 148 - 264
Target Start/End: Original strand, 1632553 - 1632669
Alignment:
| Q |
148 |
ctagttttctaatattgttcatgttatgtttctgcagttgagaaatatgaaaggtgggcataggcagcgagtagggtctttggcatggaataaccacaca |
247 |
Q |
| |
|
||||||| |||| ||| ||| |||| ||||||||||||||||| | |||||||||| |||||||||||||||||||||||||||||||| ||||||| | |
|
|
| T |
1632553 |
ctagtttgctaacattattcttgtttggtttctgcagttgagaactttgaaaggtggtcataggcagcgagtagggtctttggcatggaacaaccacata |
1632652 |
T |
 |
| Q |
248 |
ctcacaactggagggat |
264 |
Q |
| |
|
|||||||| |||||||| |
|
|
| T |
1632653 |
ctcacaaccggagggat |
1632669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 1 - 81
Target Start/End: Original strand, 1632428 - 1632508
Alignment:
| Q |
1 |
tcctgatggccgtcatattggcattggcttgaacaactctgaagtgcagctatgggatacagcttcagatagacaggtttt |
81 |
Q |
| |
|
||||||||| ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
1632428 |
tcctgatgggcgtcatattggtattggtttgaacaactctgaagtgcagctatgggatacagcttcagataaacaggtttt |
1632508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University