View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5308_high_8 (Length: 237)
Name: NF5308_high_8
Description: NF5308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5308_high_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 185; Significance: 1e-100; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 12 - 220
Target Start/End: Complemental strand, 13078178 - 13077970
Alignment:
| Q |
12 |
ataattctgaactttatgattgctggaaaagacacaagtgccaatactttgtcatggttcttctacatgctttgcaagaaccctcttatacaagaaaaag |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13078178 |
ataattctgaactttatgattgctggaaaagacacaagtgccaatactttgtcatggttcttctacatgctttgcaagaaccctcttatacaagaaaaag |
13078079 |
T |
 |
| Q |
112 |
tggcacaagaagtgataaatgttacttctacaagccaagaaagcagccttaatttagatgaatttgtgacaaatatttcggatgctacccttgacaaaat |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| | |||||||| |||||||| ||||||||||| |
|
|
| T |
13078078 |
tggcacaagaagtgataaatgttacttctacaagccaagaaagcaacctcaatttagatgaatttgtgtccaatatttcagatgctacacttgacaaaat |
13077979 |
T |
 |
| Q |
212 |
gcattatct |
220 |
Q |
| |
|
||||||||| |
|
|
| T |
13077978 |
gcattatct |
13077970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 12 - 98
Target Start/End: Complemental strand, 13114277 - 13114191
Alignment:
| Q |
12 |
ataattctgaactttatgattgctggaaaagacacaagtgccaatactttgtcatggttcttctacatgctttgcaagaaccctctt |
98 |
Q |
| |
|
|||||||| ||||||||||| ||||| |||||||| | ||| |||||| | |||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
13114277 |
ataattctcaactttatgatagctggcaaagacactactgcaaatactctttcatggttcttctatatgctatgcaagaaccctctt |
13114191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 12 - 95
Target Start/End: Complemental strand, 13098149 - 13098066
Alignment:
| Q |
12 |
ataattctgaactttatgattgctggaaaagacacaagtgccaatactttgtcatggttcttctacatgctttgcaagaaccct |
95 |
Q |
| |
|
|||||||| ||||||||||| ||||| |||||||| | ||| |||||| | |||||||||||||||||| | |||||||||||| |
|
|
| T |
13098149 |
ataattctcaactttatgatagctggcaaagacaccactgcaaatactctttcatggttcttctacatgttatgcaagaaccct |
13098066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 12 - 98
Target Start/End: Complemental strand, 13103303 - 13103217
Alignment:
| Q |
12 |
ataattctgaactttatgattgctggaaaagacacaagtgccaatactttgtcatggttcttctacatgctttgcaagaaccctctt |
98 |
Q |
| |
|
|||||||| ||||||||||| ||||| ||||| || | ||| || ||| | |||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
13103303 |
ataattctcaactttatgatagctggcaaagataccactgcaaacactctttcatggttcttctatatgctatgcaagaaccctctt |
13103217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University