View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5310_high_12 (Length: 251)

Name: NF5310_high_12
Description: NF5310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5310_high_12
NF5310_high_12
[»] chr4 (1 HSPs)
chr4 (6-104)||(6274870-6274968)


Alignment Details
Target: chr4 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 6 - 104
Target Start/End: Original strand, 6274870 - 6274968
Alignment:
6 tgtcaacaaatcatagacaatcatgtgtatgacttacgaggaaaatcgatcttttctaatgatcattgaacggtaatgattgattaacaaggtaaaaac 104  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| | |||||||| ||||||| ||||||||    
6274870 tgtcaactaatcatagacaatcatgtgtatgacttacgaggaaaatcgatcttttctaatgatcatcgaacagaaatgattggttaacaacgtaaaaac 6274968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University