View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5310_high_13 (Length: 249)
Name: NF5310_high_13
Description: NF5310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5310_high_13 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 13 - 249
Target Start/End: Complemental strand, 38625782 - 38625546
Alignment:
| Q |
13 |
aatatgagggagcgtagatcttgaaattttctgtgatcttttctgatttgcagtgggagaatcatggttaactgattgtttttcctccttgtatctttct |
112 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38625782 |
aatacgagggagcatagatcttgaaattttctgtgatcttttctgatttgcagtgggagaatcatggttaactgattgtttttcctccttgtatctttct |
38625683 |
T |
 |
| Q |
113 |
gtttcgctgtcctttttgttgataatgacaagaaaattaactatactaatcattgatgccctgcttctgttataacagtcatctaaagggatgcgttcat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38625682 |
gtttcgctgtcctttttgttgataatgacaagaaaattaactatactaatcattgatgccctgcttctgttataacagtcatctaaagggatgcgttcat |
38625583 |
T |
 |
| Q |
213 |
caaaattctgtttgcatccagcaggagacacaccttc |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38625582 |
caaaattctgtttgcatccagcaggagacacaccttc |
38625546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 186 - 246
Target Start/End: Original strand, 34623633 - 34623693
Alignment:
| Q |
186 |
aacagtcatctaaagggatgcgttcatcaaaattctgtttgcatccagcaggagacacacc |
246 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
34623633 |
aacagtcatctaaaggaatgcgttcatcaaagttctgtttgcatccagcaggagacacacc |
34623693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University