View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5310_high_17 (Length: 241)
Name: NF5310_high_17
Description: NF5310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5310_high_17 |
 | |
|
| [»] scaffold0775 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0775 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: scaffold0775
Description:
Target: scaffold0775; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 3369 - 3591
Alignment:
| Q |
1 |
ccattttcatttttccctcctctcataccaaaatattccccctcnnnnnnnggctcacaaaccccaaaataattatcccacaaattcatactcacaaact |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3369 |
ccattttcgtttttccctcctctcataccaaaatattccccctctttttttgactcacaaaccccaaaataattatcccacaaattcatactcacaaact |
3468 |
T |
|
| Q |
101 |
caagatgaactcaatattcacaaacccaaaactcatcttcaaaactttcgagttccaaaaactcaagatgaacccaaaccttaaaataaacttaacccaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3469 |
caagatgaactcaatattcacaaacccaaaactcatcttcaaaactttccagttccaaacactcaagatgaacccaaaccttaaaataaacttaacccaa |
3568 |
T |
|
| Q |
201 |
aattatccccaaacactcaatca |
223 |
Q |
| |
|
|||| |||||||||||||||||| |
|
|
| T |
3569 |
aattttccccaaacactcaatca |
3591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University