View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5310_high_19 (Length: 237)
Name: NF5310_high_19
Description: NF5310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5310_high_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 29642746 - 29642529
Alignment:
| Q |
1 |
cagacacgacactgacacgtggataccaaacacacatattttgaaaataataattgttagtaatcgcaggtgtttatgttgtatccgtatatgacaccga |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29642746 |
cagacacaacactgacacgtggataccaaacacacatattttgaaaataataattgttagtaatcgcaggtgtttatgttgtatccgtatatgacaccga |
29642647 |
T |
|
| Q |
101 |
tatttgtcagagtttgaacacgcctacaatatgaagtgtcgatcatatgttttcagccatcaactatttcatcataatcaactactaattttgtaatatt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29642646 |
tatttgtcagagtttgaacacgcctacaatatgaagtgtcgatcatatgttttcagctatcaactatttcatcataatcaactactaattttgtaatatt |
29642547 |
T |
|
| Q |
201 |
aggataatattgatgatg |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
29642546 |
aggataatattgatgatg |
29642529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University