View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5310_high_6 (Length: 346)
Name: NF5310_high_6
Description: NF5310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5310_high_6 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 313; Significance: 1e-176; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 313; E-Value: 1e-176
Query Start/End: Original strand, 18 - 346
Target Start/End: Original strand, 43700196 - 43700524
Alignment:
| Q |
18 |
gtaaggttatgttatcttatgttatgttgttggtactatttacatcacttatatcttctagctatatatgcttatgttgggaaaggaattcaacctattt |
117 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43700196 |
gtaaggttatgttatcttatgttacgttgttggtactatttacatcacttatatcttctagctatatatgcttatgttgggaaaggaattcaacctattt |
43700295 |
T |
 |
| Q |
118 |
ggatatattatatcttatggtcctaattcagcacgacattaggttgatgggaatatatacagtgtcacttcaacgctaagtttttatttttgacacgatg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43700296 |
ggatatattatatcttatggtcctaattcagcacgacattaggttgatgggaatatatacagtgtcacttcaacgctaagtttttatttttgacacgatg |
43700395 |
T |
 |
| Q |
218 |
ttattatagtatttcatcatgttaatatgataaacatgctctaaatagattaagatcgctgagtagaaaggacacaaatctttataaataaagggaaaaa |
317 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
43700396 |
ttattatagtatttcatcatgttaaaatgataaacatgctctaaatagattaagatcgctgagtacaaaggacacaaatctttataaataaagggaaaaa |
43700495 |
T |
 |
| Q |
318 |
agtgataagtttggatatgagagtataat |
346 |
Q |
| |
|
||||||||||||||||||||||| ||||| |
|
|
| T |
43700496 |
agtgataagtttggatatgagagcataat |
43700524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University