View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5310_low_16 (Length: 241)
Name: NF5310_low_16
Description: NF5310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5310_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 61 - 223
Target Start/End: Complemental strand, 49607567 - 49607411
Alignment:
| Q |
61 |
gtggggtgtcaaggaaggagcaatgtgttaaaaaaccttgttagtagagtacatgcaatatttgcgtcgtaatatgagtgcttgaaacattatagatgcg |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49607567 |
gtggggtgtcaaggaaggagcaatgtgttaaaaaatcttgttagtagagtacatgcaatatttgcgtcgtaatatgagtgcttgaaacattatagatgcg |
49607468 |
T |
 |
| Q |
161 |
gtaatagtatggcattggcaagggttcaatatattatataatttcccgtttgaaggtggtgct |
223 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||||||||||||||| |||||||| |
|
|
| T |
49607467 |
gtaatagtat------ggcaagggtttaatatattatataatttcccgtttgaaagtggtgct |
49607411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 68 - 157
Target Start/End: Complemental strand, 49612749 - 49612658
Alignment:
| Q |
68 |
gtcaaggaaggagcaatgtgttaaaaaac--cttgttagtagagtacatgcaatatttgcgtcgtaatatgagtgcttgaaacattatagat |
157 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||||||||||||| | | ||||||||| ||| |||||||||||||||| ||||| |
|
|
| T |
49612749 |
gtcaaggaaggagcactgtgttaaaaaaaatcttgttagtagagtacatgcgagagttgcgtcgtcataggagtgcttgaaacattttagat |
49612658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University