View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5310_low_2 (Length: 513)
Name: NF5310_low_2
Description: NF5310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5310_low_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 311; Significance: 1e-175; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 26 - 349
Target Start/End: Complemental strand, 54660479 - 54660154
Alignment:
| Q |
26 |
aacattatgattaatgttgaaaa--ttcatcaagcagctggagggtcagcagaagtccagaaaatatctttcaaagcaggacgaagctctttgctacaga |
123 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54660479 |
aacattatgattaatgatgaaaaaattcatcaagcagctggagggtcagcagaagtccagaaaatatctttcaaagcaggacgaagctctttgctacaga |
54660380 |
T |
|
| Q |
124 |
actgattatactccaaagtatcacccttatctttcttcacctccaccaccagaaacgacggtgtcaccgcgtaaatatccgctgcaatagccaactttcc |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54660379 |
actgattatactccaaagtatcacccttatctttcttcacctccaccaccagaaacgacggtgtcaccgcgtaaatatccgctgcaatagccaactttcc |
54660280 |
T |
|
| Q |
224 |
tttcctccctctttcttgcccttgaagtctcaccttcgtatcactactcttcacatcaaatttcaccgccttcgccacttgttccagtttcgatatcact |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54660279 |
tttcctccctctttcttgcccttgaagtctcaccttcgtatcactactcttcacatcaaatttcaccgccttcgccacttgttccagtttcgatatcact |
54660180 |
T |
|
| Q |
324 |
ctactcggcgtcccacccgttgcaaa |
349 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
54660179 |
ctactcggcgtcccacccgttgcaaa |
54660154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 128; E-Value: 6e-66
Query Start/End: Original strand, 386 - 513
Target Start/End: Complemental strand, 54660117 - 54659990
Alignment:
| Q |
386 |
aaacaacggagacaaatcaaatccttctgatagtgaaattatatgaaaagcattcattgtcgtcgatgatttctcacactccataaattcaaacacctta |
485 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54660117 |
aaacaacggagacaaatcaaatccttctgatagtgaaattatatgaaaagcattcattgtcgtcgatgatttctcacactccataaattcaaacacctta |
54660018 |
T |
|
| Q |
486 |
tcttcttcctcttctttctccttcttcc |
513 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
54660017 |
tcttcttcctcttctttctccttcttcc |
54659990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University