View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5310_low_21 (Length: 227)
Name: NF5310_low_21
Description: NF5310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5310_low_21 |
 | |
|
| [»] scaffold0775 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0775 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: scaffold0775
Description:
Target: scaffold0775; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 25 - 227
Target Start/End: Original strand, 2963 - 3165
Alignment:
| Q |
25 |
attgatgatttattttctccttggtcatctggctagattaataagcaagttaggtacaacatggaaatattctaaaaaccataacattcactactagnnn |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2963 |
attgatgatttattttctccttggtcatctggctagattaataagcaagttaggtacaacatggaaatattctaaaaaccataacattcactactagaaa |
3062 |
T |
|
| Q |
125 |
nnnntgatttagggacggattttagggagggaaggcaatccctcactaatagtgacggatttagggaggggtttttgtattttccacaaaaactgagttg |
224 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3063 |
aacatgatctagggacggattttagggagggaaggcaatccctcactaatagtgacggatttagggaggggtttttgtattttccacaaaaactgagttg |
3162 |
T |
|
| Q |
225 |
cta |
227 |
Q |
| |
|
||| |
|
|
| T |
3163 |
cta |
3165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 129 - 215
Target Start/End: Complemental strand, 16433381 - 16433295
Alignment:
| Q |
129 |
tgatttagggacggattttagggagggaaggcaatccctcactaatagtgacggatttagggaggggtttttgtattttccacaaaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| ||||||||||||||| ||||||||| || |||| |||||||||| |||| |
|
|
| T |
16433381 |
tgatttagggacggattttagggagggaagacaatccttcactaatagtgacgaatttagggacggattttcgtattttccataaaa |
16433295 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 130 - 191
Target Start/End: Original strand, 43597088 - 43597149
Alignment:
| Q |
130 |
gatttagggacggattttagggagggaaggcaatccctcactaatagtgacggatttaggga |
191 |
Q |
| |
|
||||||| ||||||||||||| |||||| | |||||||||||||| |||||||||||||||| |
|
|
| T |
43597088 |
gatttagagacggattttaggaagggaaagtaatccctcactaattgtgacggatttaggga |
43597149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 129 - 224
Target Start/End: Original strand, 36967975 - 36968070
Alignment:
| Q |
129 |
tgatttagggacggattttagggagggaaggcaatccctcactaatagtgacggatttagggaggggtttttgtattttccacaaaaactgagttg |
224 |
Q |
| |
|
|||||||| |||||||||| ||||||||| ||||||||||||| |||||||||||||||| || |||| | |||| ||||||| ||||||| |
|
|
| T |
36967975 |
tgatttagagacggattttcgggagggaaactaatccctcactaactgtgacggatttagggacggattttcgaatttctcacaaaacttgagttg |
36968070 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University