View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5310_low_22 (Length: 216)
Name: NF5310_low_22
Description: NF5310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5310_low_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 114; Significance: 5e-58; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 85 - 206
Target Start/End: Original strand, 12274155 - 12274276
Alignment:
| Q |
85 |
ctaaagttgctatttgaatattgaatgaacactaacatattgcatatttttgcgaacagatgcacgcagaattccaagttctttctccgttggtgtccac |
184 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12274155 |
ctaaaattgctatttgaatattgaatgaacactaacatattgcatatttttgcgaacagatgcacgcagaattccaagttctttctccgttggtgtccac |
12274254 |
T |
 |
| Q |
185 |
cagagagactcatattcttcga |
206 |
Q |
| |
|
||||||||||||| |||||||| |
|
|
| T |
12274255 |
cagagagactcattttcttcga |
12274276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University