View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5310_low_9 (Length: 270)
Name: NF5310_low_9
Description: NF5310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5310_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 121; Significance: 5e-62; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 97 - 225
Target Start/End: Original strand, 34963168 - 34963296
Alignment:
| Q |
97 |
ctatctgaaaagagggaatacacaaaagttggacttgattagaaaaactactggtacaatgttgttttgttcacttctgatgagcaggatggtacaaatt |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
34963168 |
ctatctgaaaagagggaatacacaaaagttggacttgattagaaaaactactgttacaatgttgttttgatcacttctgatgagcaggatggtacaaatt |
34963267 |
T |
 |
| Q |
197 |
tggagagatcatcactaagcagaagcaga |
225 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
34963268 |
tggagagatcatcactaagcagaagcaga |
34963296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 77; Significance: 8e-36; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 89 - 202
Target Start/End: Original strand, 18421301 - 18421416
Alignment:
| Q |
89 |
cctataatctatctgaaaagagggaatacacaaaagttggacttgattagaaaaactactggtac--aatgttgttttgttcacttctgatgagcaggat |
186 |
Q |
| |
|
|||| ||||| |||||||||| ||||||||||| ||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
18421301 |
cctacaatctttctgaaaagaaggaatacacaacagttggacttgattagaaaaactactggtacaaaatgttgttttgatcacttctgatgagcaggat |
18421400 |
T |
 |
| Q |
187 |
ggtacaaatttggaga |
202 |
Q |
| |
|
|||||| || |||||| |
|
|
| T |
18421401 |
ggtacagatatggaga |
18421416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University