View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5311_high_31 (Length: 360)
Name: NF5311_high_31
Description: NF5311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5311_high_31 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 305; Significance: 1e-171; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 305; E-Value: 1e-171
Query Start/End: Original strand, 5 - 342
Target Start/End: Original strand, 4323772 - 4324109
Alignment:
| Q |
5 |
tgtcgaagaatatgtggtttatgttaataattcatggcaacttgtactccccctagtttgtatgataattgtcattgacattggttcccaattcaggcta |
104 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4323772 |
tgtcaaagaaaatgtggtttatgttaataattcatggcaacttgtactccccctagtttgtatgataattgtcattgacattggttcccaattcaggcta |
4323871 |
T |
 |
| Q |
105 |
actgggaaaagttatttattagtcgaggtttcttatacaaatcatcattgttcattcttctttaggctgtgaggcnnnnnnntgacggcttggcggaaga |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4323872 |
actgggaaaagttatttattagtcgaggtttcttatacaaatcatcattgttcattcgtctttaggctgtgaggcaaaaaaatgacggcttggcggaaga |
4323971 |
T |
 |
| Q |
205 |
agtagaacttcttaagcttagacttcaagaactggaacagctggcccggggacgaggactcactggcattctaaatttcaaacacattattagtaaggaa |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4323972 |
agtagaacttcttaagcttagacttcaagaactggaacagctggcccggggacgaggactcactggcattctaaatttcaaacacattattagtaaggaa |
4324071 |
T |
 |
| Q |
305 |
aatgaaaagacggagaaaactgcttgacctgatgaaaa |
342 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4324072 |
aatgaaaagacggagaaaactgcttgacctgatgaaaa |
4324109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University