View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5311_high_32 (Length: 336)
Name: NF5311_high_32
Description: NF5311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5311_high_32 |
 |  |
|
| [»] scaffold0365 (1 HSPs) |
 |  |  |
|
| [»] scaffold0400 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0365 (Bit Score: 317; Significance: 1e-179; HSPs: 1)
Name: scaffold0365
Description:
Target: scaffold0365; HSP #1
Raw Score: 317; E-Value: 1e-179
Query Start/End: Original strand, 1 - 321
Target Start/End: Original strand, 2507 - 2827
Alignment:
| Q |
1 |
atatttaataaggatgaaagttggaggaagaaattgcaaggtcttgttcctgctgatgggataaaagtgaagcatattcgtacaggtgaagatgtgaagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2507 |
atatttaataaggatgaaagttggaggaagaaattgcaaggtcttgttcctgctgatgggataaaagtgaagcatattcgtacaggtgaagatgtgaagc |
2606 |
T |
 |
| Q |
101 |
tttcgaggagggttgtcgcggtttttgttatgatgactatggctgatttttgtgatcagctttttggttttcaagatatgttgtttgagaactttgatgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2607 |
tttcgaggagggttgtcgcggtttttgttatgatgactatggctgatttttgtgatcagctttttggttttcaagatatgttgtttgagaactttgatgg |
2706 |
T |
 |
| Q |
201 |
taggcttgagtttaaagggaacaattttggtgctgtttggcccggaaatggtaagccgggtttgtggttgaattctatttcgaggatgggagctgtttac |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2707 |
taggcttgagtttaaagggaacaattttggtgctgtttggccgggaaatggtaagccgggtttgtggttgaattctatttcgaggatgggagctgtttac |
2806 |
T |
 |
| Q |
301 |
aatttgattctgagagaggaa |
321 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
2807 |
aatttgattctgagagaggaa |
2827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0400 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: scaffold0400
Description:
Target: scaffold0400; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 103 - 321
Target Start/End: Original strand, 1965 - 2183
Alignment:
| Q |
103 |
tcgaggagggttgtcgcggtttttgttatgatgactatggctgatttttgtgatcagctttttggttttcaagatatgttgtttgagaactttgatggta |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1965 |
tcgaggagggttgtcgcggtttttgttatgatgactatggctgatttttgtgatcagctttttggttttcaagatatgttgtttgagaactttgatggta |
2064 |
T |
 |
| Q |
203 |
ggcttgagtttaaagggaacaattttggtgctgtttggcccggaaatggtaagccgggtttgtggttgaattctatttcgaggatgggagctgtttacaa |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2065 |
ggcttgagtttaaagggaacaattttggtgctgtttggccgggaaatggtaagccgggtttgtggttgaattctatttcgaggatgggagctgtttacaa |
2164 |
T |
 |
| Q |
303 |
tttgattctgagagaggaa |
321 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
2165 |
tttgattctgagagaggaa |
2183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University