View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5311_high_45 (Length: 280)

Name: NF5311_high_45
Description: NF5311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5311_high_45
NF5311_high_45
[»] chr1 (2 HSPs)
chr1 (1-84)||(35906942-35907026)
chr1 (207-259)||(35907149-35907201)


Alignment Details
Target: chr1 (Bit Score: 77; Significance: 9e-36; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 1 - 84
Target Start/End: Original strand, 35906942 - 35907026
Alignment:
1 tgtagaaattacctacctggattggtggaacatgttccaaaccaggcaagaac-aaaaattaaggtgaagttttgattgttatta 84  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
35906942 tgtagaaattacctacctggattggtggaacatgttccaaaccaggcaagaacaaaaaattaaggtgaagttttgattgttatta 35907026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 207 - 259
Target Start/End: Original strand, 35907149 - 35907201
Alignment:
207 catgaacgttaagtttacatggttgagaagcagtgatagggagtgaggatcgt 259  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
35907149 catgaacgttaagtttacatggttgagaagcagtgatagggagtgaggatcgt 35907201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University