View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5311_high_70 (Length: 227)
Name: NF5311_high_70
Description: NF5311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5311_high_70 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 18 - 215
Target Start/End: Original strand, 4770415 - 4770612
Alignment:
| Q |
18 |
ttaaccctgtctcccaaagttgatatttcttcccttaccaattgtagttgaagtttatcaagagtttgtcttagatcagatagaagttctggtcgataat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4770415 |
ttaaccctgtctcccaaagttgatatttcttcccttaccaattgtagttgaagtttatcaagagtttgtcttagatcagatagaagttctggtcgataat |
4770514 |
T |
 |
| Q |
118 |
cgcagctgatagatgctttgtaaagaaatgatccaccattttcatatggttcaactttcacttcatcgtcatctgttgggattgaataacctttgctt |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||| |||||||||||||||||| |
|
|
| T |
4770515 |
cgcagctgatagatgctttgtaaagaaatgatccaccattttcatatggttcaactttcacttcatcatcgtctgttggaattgaataacctttgctt |
4770612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University