View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5311_high_72 (Length: 223)
Name: NF5311_high_72
Description: NF5311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5311_high_72 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 19 - 170
Target Start/End: Original strand, 35085161 - 35085312
Alignment:
| Q |
19 |
ataatgtccttacattttttctattgcagaagacacgaaatgaatcaaaaagatctctggattcactatccatgacatcttcgtcgttggctgcaccata |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35085161 |
ataatgtccttacattttttctattgcagaagacacgaaatgaatcaaaaagatctctggattcactatccatgacatcttcgtcgttggctgcaccata |
35085260 |
T |
|
| Q |
119 |
ttcattcaaaaactaaaattaataaaatacatttttatggaagaagaattag |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35085261 |
ttcattcaaaaactaaaattaataaaatacatttttatggaagaagaattag |
35085312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University