View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5311_high_73 (Length: 222)
Name: NF5311_high_73
Description: NF5311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5311_high_73 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 8 - 219
Target Start/End: Complemental strand, 40230667 - 40230456
Alignment:
| Q |
8 |
aatgttttatgattgtctggttatgaaatcatatgtctgtctgattgatcttttagaataattgatcatcttaatttcgcaaacgacaataatttgatta |
107 |
Q |
| |
|
||||||||||||||||||| |||| || | ||||||| ||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
40230667 |
aatgttttatgattgtctgattattaacttatatgtcgctctgactgatcttttagaataattgatcatcttaatttcgcaatcgacaataatttgatta |
40230568 |
T |
 |
| Q |
108 |
ttcaattagatgaaaggtatataaaacgtgtcactcgtatactcaattttttatgtgacccatatactcaattttgtctatgttttgcattttgtttatt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40230567 |
ttcaattagatgaaaggtatataaaacgtgtcactcgtatactcaattttttatgtgacccatatactcaattttgtctatgttttgcattttgtttatt |
40230468 |
T |
 |
| Q |
208 |
aacccgtatatt |
219 |
Q |
| |
|
|||||||||||| |
|
|
| T |
40230467 |
aacccgtatatt |
40230456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University