View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5311_high_74 (Length: 219)
Name: NF5311_high_74
Description: NF5311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5311_high_74 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 7241246 - 7241028
Alignment:
| Q |
1 |
cctgcagctggtgaaaatgctggctagcacaacaggaacatatggaaaacatcttagaaaagagatttctgaggtagttttcacaatcagcaatatcaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7241246 |
cctgcagctggtgaaaatgctggctagcacaacaggaacatatggaaaacatcttagaaaagagatttctgaggtagttttcacaatcagcaatatcaga |
7241147 |
T |
|
| Q |
101 |
gatattttaagacatggtgagaaacaccccttgttacagaaactgagcatagaaattttaacaagtcttgcattggaagatgaggcatcagaaaggattg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7241146 |
gatattttaagacatggtgagaaacaccccttgttacagaaactgagcatagaaattttaacaagtcttgcattggaagatgaggcatcagaaaggattg |
7241047 |
T |
|
| Q |
201 |
gaggtacaggtggagtgct |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
7241046 |
gaggtacaggtggagtgct |
7241028 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 75 - 219
Target Start/End: Original strand, 48732749 - 48732893
Alignment:
| Q |
75 |
tagttttcacaatcagcaatatcagagatattttaagacatggtgagaaacaccccttgttacagaaactgagcatagaaattttaacaagtcttgcatt |
174 |
Q |
| |
|
|||| ||||| ||||| ||||| ||||||||||||| ||||| || | ||| || | ||||||||||||||||||| |||||||||| || ||||| |
|
|
| T |
48732749 |
tagtgttcactatcagtaatattagagatattttaaagcatggagaaagacatccacttctacagaaactgagcatagagattttaacaaacctagcatt |
48732848 |
T |
|
| Q |
175 |
ggaagatgaggcatcagaaaggattggaggtacaggtggagtgct |
219 |
Q |
| |
|
|| ||||| ||| |||| || ||||| |||||||||||| |||| |
|
|
| T |
48732849 |
agatgatgatgcaacagagagaattggtggtacaggtggaatgct |
48732893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University