View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5311_high_76 (Length: 204)
Name: NF5311_high_76
Description: NF5311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5311_high_76 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 132; Significance: 9e-69; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 132; E-Value: 9e-69
Query Start/End: Original strand, 19 - 150
Target Start/End: Original strand, 38512128 - 38512259
Alignment:
| Q |
19 |
tataagtaggagtttcagtaaaggtgttaaaacttaaaatagtgaaaggcttaaaacgatacatttcatatttgacgagttcattagttcgtactaagct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38512128 |
tataagtaggagtttcagtaaaggtgttaaaacttaaaatagtgaaaggcttaaaacgatacatttcatatttgacgagttcattagttcgtactaagct |
38512227 |
T |
 |
| Q |
119 |
cacatgtgatgttgctggatcagtagtgtctt |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
38512228 |
cacatgtgatgttgctggatcagtagtgtctt |
38512259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University