View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5311_low_30 (Length: 361)
Name: NF5311_low_30
Description: NF5311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5311_low_30 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 293; Significance: 1e-164; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 1 - 356
Target Start/End: Original strand, 10049813 - 10050175
Alignment:
| Q |
1 |
gagtcatcaatcttttatcaaatgccttagattgactagagttattgaatgccctaaatctagatctgacaattatatatgtacatggtaaaccttattg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10049813 |
gagtcatcaatcttttatcaaatgccttggattgacaagagttattgaatgccctaaatatagatctgacaattatatatgtacatggtaaaccttattg |
10049912 |
T |
 |
| Q |
101 |
cttatgcaaaattc-------tatataaatgtaatttcttcttttttattgcttagctatgatgcgaattcgcgatatagatacctaaaatttatccaac |
193 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||| |||||||||| |||||||||| |||||||||||| |
|
|
| T |
10049913 |
cttatgcaaaattctatattctatataaatgtaatttcttgttttttattgcttagctatgatgcaaattcgcgatttagatacctagaatttatccaac |
10050012 |
T |
 |
| Q |
194 |
cattgactgattcattcttatacaatgtatatttcacatattgtgttacatgcattatgtgcagctttagcactagtagacttgtaaagtttttgatgtt |
293 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10050013 |
cattgactgattcattcttatacaatatatatttcacataatgtgttacatgcattatgtgcagctttagcactagtagacttgtaaagtttttgatgtt |
10050112 |
T |
 |
| Q |
294 |
gcaactattttataatatgttctatcagattggatgcgcattggtgctttttcctttgcttct |
356 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
10050113 |
gtaactattttataatatgttctatcagattggatgcgcattggtgctttttcctttgattct |
10050175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University